NEET Q4 Unofficial Answer Key 2024NEET Q4 Unofficial Answer Key 2024: The answers for all 200 questions solved by the subject experts for NEET Set Code Q4 question paper 2024 are provided here. Access the links from the table of contents to jump to the respective subject answer key.
Also Read |
| Links | | ||
|---|---|---|
| NEET Answer Key 2024 Unofficial (All Sets) | NEET Question Paper 2024 | NEET 2024 Exam Analysis |
| NEET Expected Rank 2024 | NEET Expected Percentile Score 2024 | NEET Expected Cutoff Score 2024 |
Table of Contents |
NEET Q4 Unofficial Answer Key 2024 for Botany
Here is the unofficial NEET 2024 answer key for Set Code Q4 Botany subject:Q4 Botany Section A
| Question Number | Set Q4 Correct Answer | Question Number | Set Q4 Correct Answer |
|---|---|---|---|
| 101 | (3) docs not affect mature monocotyledonous plants. | 119 | (2) bb |
| 102 | (4) 3 molecules of ATP and 2 molecules of NADPH | 120 | (1) A, C, D, and E only |
| 103 | (1) C | 121 | (4) A, B, and D only |
| 104 | (1) A-III, B-II, C-IV, D-I | 122 | (4) Promotor, Structural Gene, Terminator |
| 105 | (4) (a) Perigynous, (b) Perigynous | 123 | (2) 6 bp |
| 106 | (1) A-III, B-II, C-IV, D-I | 124 | (1) Zinc |
| 107 | (1) Datura | 125 | (3) A-III, B-I, C-IV, D-II |
| 108 | (4) B, C, D, and E only | 126 | (4) IUCN |
| 109 | (2) Red flowered as well as pink flowered plants | 127 | (2) Biodiversity conversion |
| 110 | (3) Dedifferentiation | 128 | (1) Totipotency |
| 111 | (3) A-III, B-IV, C-I, D-II (Out of syllabus question) | 129 | (3) Carrying Capacity |
| 112 | (3_ C, D, and E only | 130 | (1) Inward curling of leaves in monocots |
| 113 | (1) Both Statement I and Statement II are true | 131 | (2) Phospholipids |
| 114 | (2) Metaphase | 132 | (3) Competitive Inhibition |
| 115 | (3) B and C only | 133 | (3) Statement I is true but Statement II is false |
| 116 | (3) Permease | 134 | (3) C |
| 117 | (4) Statement I is false but Statement II is true | 135 | (2) A, C, D, and E only |
| 118 | (2) Mode of nutrition | --- | --- |
Q4 Botany Section B
| Question Number | Set Q4 Correct Answer | Question Number | Set Q4 Correct Answer |
|---|---|---|---|
| 136 | (2) A-II, B-I, C-IV, D-III | 144 | (2) A-III, B-IV, C-I, D-II |
| 137 | (2) A-III, B-I, C-IV, D-II | 145 | (1) Wind-pollinated plant inflorescence showing flowers with well-exposed stamens |
| 138 | (2) x (kcalm -2 ) yr -1 | 146 | (2) Circlular, double stranded |
| 139 | (3) A, C, D, and E only | 147 | (3) Statement I is true but Statement II is false |
| 140 | (2) Gibberellin | 148 | (1) A-IV, B-I, C-II, D-III |
| 141 | (1) A-IV, B-II, C-I, D-III | 149 | (1) A-II, B-IV, C-I, D-III |
| 142 | (4) The DNA-dependent DNA polymerase catalyses polymerization in 5'→3' direction. | 150 | (3) Protoplasts |
| 143 | (3) Succinyl-CoA → Succinic acid | --- | --- |
Expected Cutoff |
| Links | | |
|---|---|
| NEET General Category Expected Cutoff 2024 | NEET EWS Category Expected Cutoff 2024 |
| NEET OBC Category Expected Cutoff 2024 | NEET SC Category Expected Cutoff 2024 |
NEET Q4 Unofficial Answer Key 2024 for Zoology
Here is the unofficial NEET 2024 answer key for Set Code Q4 Zoology subject:Q4 Zoology Section A
| Question Number | Set Q4 Correct Answer | Question Number | Set Q4 Correct Answer |
|---|---|---|---|
| 151 | (2) A-II, B-I, C-IV, D-III | 169 | (3) A, B, and E only |
| 152 | (4) E-C-A-D-B | 170 | (2) A-III, B-I, C-II, D-IV |
| 153 | (3) A-III, B-I, C-III, D-I | 171 | (4) A is false but R is true |
| 154 | (2) A-IV, B-III, C-I, D-II | 172 | (2) A-II, B-IV, C-I, D-III |
| 155 | (3) Convergent Evolution | 173 | (4) A-II, B-I, C-IV, D-III |
| 156 | (1) E-C-A-D-B | 174 | (3) A-II, B-IV, C-I, D-III |
| 157 | (2) Bio-reactors are used to produce small scale bacterial cultures | 175 | (2) A only |
| 158 | (1) Uterine Fundus | 176 | (3) A-III, B-IV, C-I, D-III |
| 159 | (1) Both Statement I and Statement II are false | 177 | (4) A-III, B-I, C-IV, D-II |
| 160 | (4) Constant gene pool | 178 |
(2) (a) Skeletal - Triceps
(b) Smooth - Stomach (c) Cardiac - Heart |
| 161 | (4) Glucagon | 179 | (3) A-III, B-IV, C-I, D-II |
| 162 | (4) A-III, B-I, C-IV, D-II | 180 | (2) High pO2 and lesser H+ concentration |
| 163 | (2) 10th segment | 181 | (4) A-D-C-B |
| 164 | (1) A-II, B-IV, C-I, D-III | 182 | (4) A-III, B-IV, C-I, D-II |
| 165 | (2) A-III, B-IV, C-II, D-I | 183 |
(1) Both A and R are true and
R is the correct explanation of A |
| 166 | (3) Statement I is true but Statement II is false | 184 | (4) Valuts |
| 167 |
(2) The gene 'X' is responsible for controlling the copy number of the linked DNA
and 'Y' for protein involved in the replication of Plasmid. | 185 | (3) Tumor inducing plasmid |
| 168 | (2) 5' AUGUACCGUUUAUAGGUAAGU | --- | --- |
Q4 Zoology Section B
| Question Number | Correct Answer | Question Number | Correct Answer |
|---|---|---|---|
| 186 | (4) A-III, B-IV, C-I, D-II | 194 | (4) A-III, B-I, C-IV, D-II |
| 187 | (3) Statement I is true but Statement II is false | 195 | (1) A only |
| 188 | (1) E-A-D-C-B | 196 | (4) Statement I is false but Statement II is true |
| 189 | (1) A-IV, B-II, C-III, D-I | 197 | (1) Both Statement I and Statement II are true |
| 190 | (2) B, D, and E only | 198 | (3) A-III, B-IV, C-I, D-II |
| 191 | (3) Loop of Henle of juxta medullary nephron runs deep into medula | 199 | (4) A-IV, B-III, C-I, D-II |
| 192 | (3) Statement I is true but Statement II is false | 200 | (1) FSH, Leydig cells, Sertoli cells, spermiogencsis |
| 193 | (2) A-III, B-II, C-IV, D-I | --- | --- |
Upcoming Events of NEET 2024
| Links |
|---|
| NEET OMR Response Sheet Expected Release Date 2024 |
| NEET Result 2024 Release Date |
NEET Q4 Unofficial Answer Key 2024 for Chemistry
Here is the unofficial NEET 2024 answer key for Set Code Q4 Chemistry subject:
Q4 Chemistry Section A
| Question Number | Set Q4 Correct Answer | Question Number | Set Q4 Correct Answer |
|---|---|---|---|
| 51 | (4) Po | 69 | (3) B and E |
| 52 | (3) A-III, B-IV, C-II, D-I | 70 | (4) A, C and D |
| 53 | (1) Aqueous copper sulphate | 71 | (3) A-IV, B-I, C-II, D-III |
| 54 | (1) A-II, B-IV, C-I, D-III | 72 | (1) Both Statement I and Statement II are true |
| 55 |
(2) (i) BH
3
(ii) H 2 O 2 / OH - (iii) PCC | 73 | (3) Reaction has a tendency to go in backward direction. |
| 56 | (1) | 74 | (2) A-III, B-IV, C-I, D-II |
| 57 | (4) rate constant at two different temperatures | 75 | (3) 2,3-dimethylbutane |
| 58 | (1) A-II, B-III, C-IV, D-I | 76 | (2) Sublimation |
| 59 | (@) 250 mg | 77 | (4) |
| 60 | (1) Si < C < N < O < F | 78 | (1) Both Statement I and Statement II are true |
| 61 | (4) A-II, B-III, C-IV, D-I | 79 | (4) BaCl 2 + Na 2 SO 4 → BaSO 4 + 2NaCl |
| 62 | (4) | 80 | (1) A-I, B-IV, C-II, D-III |
| 63 | (1) - x | 81 | (2) Li < B < Be < C < N |
| 64 | (4) | 82 | (1) B and D only |
| 65 | (2) B > C > A | 83 | (3) d 4 to d 5 configuration |
| 66 | (4) | 84 | (1) 4 mol of helium |
| 67 | (1) | 85 | (1) Both Statement I and Statement II are true |
| 68 | (1) Both Statement I and Statement II are true | --- | --- |
Q4 Chemistry Section B
| Question Number | Set Q4 Correct Answer | Question Number | Set Q4 Correct Answer |
|---|---|---|---|
| 86 | (1) Ce 4+ ad Yb 2+ | 94 | (4) Dilute sulphuric acid |
| 87 | (1) B, A, D, C, E | 95 | (4) Three canonical forms can be drawn for CO 3 2- ion. |
| 88 | (1) | 96 | (1) 38.04 kJ/mol |
| 89 | (4) 413.4 calories | 97 | (2) |
| 90 | (1) propylamine | 98 | (2) 310°C |
| 91 | (4) H 3 PO 3 and POCl 3 | 99 | (1) Both Statement I and Statement II are true |
| 92 | (2) 0.315 g | 100 | (4) 0.717 |
| 93 | (2) ABC 3 | --- | --- |
NEET Q4 Unofficial Answer Key 2024 for Physics
Here is the unofficial NEET 2024 answer key for Set Code Q4 Physics subject:Q4 Physics Section A
| Question Number | Set Q4 Correct Answer | Question Number | Set Q4 Correct Answer |
|---|---|---|---|
| 1 | (4) zero | 19 | (1) strain and angle |
| 2 | (3) OR gate | 20 |
(3) both the reflected and refracted light
will be completely polarized |
| 3 | (3) there will be a central bright white fringe surrounded by a few coloured fringes | 21 | (3) A is true but R is false. |
| 4 | (2) 1 / 100(N + 1) | 22 | (2) Point P moves faster than point Q. |
| 5 | (1) 4 mm | 23 | (2) 5 m, 2s |
| 6 | (1) 8.5 cm | 24 | (3) B bar |
| 7 | (3) 4.4 mT | 25 | (2) A, B, C, and D only |
| 8 | (1) 10 | 26 | (2) 4T |
| 9 | (2) 2:1 | 27 | (3) 8 V |
| 10 | (3) 6 N | 28 | (4) 1280 π 2 |
| 11 | (4) 3.92 m s -2 | 29 | (2) 52 ohm |
| 12 | (1) A is correct but B is incorrect | 30 | (1) A-II, B-III, C-4, D-1 |
| 13 | (2) √5/2 | 31 | (4) 286, 81 |
| 14 | (1) Both Statement I and Statement II are true | 32 | (4) |
| 15 | (1) 19.8 mN | 33 | (2) 2:1 |
| 16 | (1) AB and DC | 34 | (1) zero |
| 17 | (4) Varying velocity and varying acceleration | 35 | (1) 2 µF |
| 18 | (2) A-III, B-IV, C-II, D-I | --- | --- |
Q4 Physics Section B
| Question Number | Set Q4 Correct Answer | Question Number | Set Q4 Correct Answer |
|---|---|---|---|
| 36 | (2) A, C, and E only | 44 | (3) |
| 37 | (2) 0.93 A | 45 | (2) 28 |
| 38 | (2) αt/β | 46 | (1) 5GmM/6R |
| 39 | (4) P 1 > P 2 > P 3 | 47 | (2) √2 |
| 40 | (2) M/2 | 48 | (3) A, C, and D only |
| 41 | (2) displacement current of magnitude equal to I flows in the same direction as I. | 49 | (2) 2 : 9 |
| 42 | (2) 50 x 10 3 N | 50 | (4) they originate from charges moving with uniform speed. |
| 43 | (4) | --- | --- |
NEET Set-Wise Unofficial Answer Key 2024
| Set Code | Answer Key Link |
|---|---|
| Set Q1 | NEET Q1 Unofficial Answer Key 2024 |
| Set Q2 | NEET Q2 Unofficial Answer Key 2024 |
| Set Q3 | NEET Q3 Unofficial Answer Key 2024 |
| Set Q5 | NEET Q5 Unofficial Answer Key 2024 |
| Set Q6 | NEET Q6 Unofficial Answer Key 2024 |
NEET Expected Rank Analysis 2024
| Marks Range | Detailed Expected Rank Analysis |
|---|---|
| 100 to 149 | NEET 2024 Expected Rank for 100 to 149 Marks |
| 150 to 199 | NEET 2024 Expected Rank for 150 to 199 Marks |
| 200 to 249 | NEET 2024 Expected Rank for 200 to 249 Marks |
| 250 to 299 | NEET 2024 Expected Rank for 250 to 299 Marks |
| 300 | 300 Marks in NEET 2024 means which rank? |
| 310 | 310 Marks in NEET 2024 means which rank? |
| 320 | 320 Marks in NEET 2024 means which rank? |
| 660 | 660 Marks in NEET 2024 means which rank? |
| 670 | 670 Marks in NEET 2024 means which rank? |
| 680 | 680 Marks in NEET 2024 means which rank? |
| 690 | 690 Marks in NEET 2024 means which rank? |
| 700 | NEET Rank 2024 for 700 Marks |
NEET Expected Percentile Analysis 2024
Keep visiting CollegeDekho for the latest Education News on entrance exams, board exams and admissions. You can also write to us at our email ID news@collegedekho.com.
Are you feeling lost and unsure about what career path to take after completing 12th standard?
Say goodbye to confusion and hello to a bright future!
Was this article helpful?

















